LOC569960

Ensembl ID:
ENSDARG00000003944
Human Orthologue:
NMUR1
Human Description:
neuromedin U receptor 1 [Source:HGNC Symbol;Acc:4518]
Mouse Orthologue:
Nmur1
Mouse Description:
neuromedin U receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1341898]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2066 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2066
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017787 Nonsense 113 349 1 2
Genomic Location:
Chromosome 2 (position 13174346)
KASP Assay ID:
554-3370.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTGTTGCTTGGCCTCCCGCTGGAGCTTTATGAGCTCTGGAGCAACTA[T/A]CCTTTTCTGTTTGGAATTTCTGGCTGCTACTTCAAAACCTGTCTCTTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4ex1rk7j