rrs1

Ensembl ID:
ENSDARG00000003941
ZFIN ID:
ZDB-GENE-030131-9345
Description:
ribosome biogenesis regulatory protein homolog [Source:RefSeq peptide;Acc:NP_956356]
Human Orthologue:
RRS1
Human Description:
RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17083]
Mouse Orthologue:
Rrs1
Mouse Description:
RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1929721]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44140 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125190 Nonsense 307 346 1 1
Genomic Location (Zv9):
Chromosome 24 (position 24446668)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23693546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGAGGGAAGAGGACTCGGAGTCTGCTCGGAATAATAAGAAAGGGTTT[G/T]GAAAGAAGGGACGCAAGGGAGGCATGCCTGGTAAAGGAAAAGGCAAAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link