rpa1

Ensembl ID:
ENSDARG00000003938
ZFIN ID:
ZDB-GENE-030912-3
Description:
Replication protein A 70 kDa DNA-binding subunit [Source:UniProtKB/Swiss-Prot;Acc:Q6NY74]
Human Orthologue:
RPA1
Human Description:
replication protein A1, 70kDa [Source:HGNC Symbol;Acc:10289]
Mouse Orthologue:
Rpa1
Mouse Description:
replication protein A1 Gene [Source:MGI Symbol;Acc:MGI:1915525]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2803 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa2803
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032880 Essential Splice Site 502 601 14 17
Genomic Location (Zv9):
Chromosome 15 (position 25844885)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26575668
KASP Assay ID:
554-2948.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAATGCGACAAAGAGTTCCCTGACTTCAAATATCGYCTCATGCTCTCGG[T/C]AAGGGGCTTGCTGTTGGATTTTTCTGCCCTTTCTAAAATAACACATCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link