cndp2

Ensembl ID:
ENSDARG00000003931
ZFIN ID:
ZDB-GENE-030131-5499
Description:
cytosolic non-specific dipeptidase [Source:RefSeq peptide;Acc:NP_999869]
Human Orthologue:
CNDP2
Human Description:
CNDP dipeptidase 2 (metallopeptidase M20 family) [Source:HGNC Symbol;Acc:24437]
Mouse Orthologue:
Cndp2
Mouse Description:
CNDP dipeptidase 2 (metallopeptidase M20 family) Gene [Source:MGI Symbol;Acc:MGI:1913304]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16507 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038202 Nonsense 147 474 4 11
ENSDART00000143457 Nonsense 147 474 5 12
Genomic Location:
Chromosome 19 (position 21288870)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYAGATGATAAAGGCCCTGTACTGGCCTGGTTCAACATCATTGAGGCCTA[T/A]CAGAAGATTGGACAGGTGCAAACTCTTTCTTTCTTTTTTTNNNNCCAAATGATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2vq2v0vy