cldn12

Ensembl ID:
ENSDARG00000003927
ZFIN ID:
ZDB-GENE-010328-14
Description:
claudin-12 [Source:RefSeq peptide;Acc:NP_571848]
Human Orthologue:
CLDN12
Human Description:
claudin 12 [Source:HGNC Symbol;Acc:2034]
Mouse Orthologue:
Cldn12
Mouse Description:
claudin 12 Gene [Source:MGI Symbol;Acc:MGI:1929288]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17766 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17766
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025877 Nonsense 177 341 3 3
ENSDART00000128729 Nonsense 177 341 2 2
Genomic Location:
Chromosome 16 (position 46073501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTAAATGAGCGCTACGATCATTTATTTGCTGTTGAGTTTGGGGTGTA[T/A]GTGGCCATMGGMAGTGCTGGTGGTYTAATCCTGGCTGCTCTGCTGATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/71ym59bp