cx28.6

Ensembl ID:
ENSDARG00000003925
ZFIN ID:
ZDB-GENE-040406-4
Description:
connexin 28.6 [Source:RefSeq peptide;Acc:NP_001007213]
Human Orthologues:
GJB4, GJB5
Human Descriptions:
gap junction protein, beta 4, 30.3kDa [Source:HGNC Symbol;Acc:4286]
gap junction protein, beta 5, 31.1kDa [Source:HGNC Symbol;Acc:4287]
Mouse Orthologues:
Gjb4, Gjb5
Mouse Descriptions:
gap junction protein, beta 4 Gene [Source:MGI Symbol;Acc:MGI:95722]
gap junction protein, beta 5 Gene [Source:MGI Symbol;Acc:MGI:95723]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42890 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012889 Nonsense 234 251 1 1
Genomic Location (Zv9):
Chromosome 17 (position 14553731)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14704559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGACCAGCACAAAGATCCAAAACACATGATCCAACTCTTTCAAGCAGA[C/T]AGAACTTAATTTCACAAAAAGTAAAAGAGAAAAAAATAGACAATACAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link