ftr01

Ensembl ID:
ENSDARG00000003909
ZFIN ID:
ZDB-GENE-070705-491
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8E7R9]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32855 Nonsense Available for shipment Available now
sa19690 Nonsense Available for shipment Available now
sa39783 Nonsense Mutation detected in F1 DNA During 2016
sa5717 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa32855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100524 Nonsense 146 556 1 6
ENSDART00000132224 Nonsense 146 355 1 5
Genomic Location (Zv9):
Chromosome 2 (position 11462021)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11887117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGAATCTGTTTAAAGACAGGAGACACAATCTATTGGATCCCACTAGA[C/T]AACTCCATGAGATGATCTGCCCAAAACACGACAAACCACTGGAAATCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19690
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100524 Nonsense 168 556 1 6
ENSDART00000132224 Nonsense 168 355 1 5
Genomic Location (Zv9):
Chromosome 2 (position 11462087)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11887183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCCCAAAACACGACAAACCACTGGAAATCTACTGTCGTACTGACCTG[C/T]AGTGCATTTGTTATCGATGTTTAATGGATGAACATAAAAACCATGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100524 Nonsense 271 556 3 6
ENSDART00000132224   None 355 None 5
Genomic Location (Zv9):
Chromosome 2 (position 11464170)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11889266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGACACGACTGATCCAAGATCAGGAAAAGGCTGCAGTGAGTGAAGTT[G/T]AAAAACTCTCGGAGCAGCTGGAGGAGGAAATTGATGATCTTAGGAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5717
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100524 Nonsense 450 556 6 6
ENSDART00000132224   None 355 None 5
ENSDART00000100524 Nonsense 450 556 6 6
ENSDART00000132224   None 355 None 5
Genomic Location (Zv9):
Chromosome 2 (position 11468402)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11893498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCTGTTATTGGGAGGTTGAGTGGAGTGGAATTAAYGGTGTGTGTATAT[C/A]AGTGTCRTATAAGAGCATCAKCAGAAAGGCATTGTTTAATGAAGATATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link