sbno2a

Ensembl ID:
ENSDARG00000003882
ZFIN ID:
ZDB-GENE-100629-3
Description:
Strawberry notch homologue 2a [Source:UniProtKB/TrEMBL;Acc:D6RUV4]
Human Orthologue:
SBNO2
Human Description:
strawberry notch homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29158]
Mouse Orthologue:
Sbno2
Mouse Description:
strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39505 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074354 Essential Splice Site 342 1032 9 26
Genomic Location (Zv9):
Chromosome Zv9_scaffold3557 (position 68020)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 57095293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCAAGGACATCGACGCTCCTAACATCCCTGTGTTTGCATTAAATAAG[G/A]TTTGTCATATGAAGTTCTGCATTTGATCAGAGTTTGATTGTGAATTTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link