PBRM1 (1 of 2)

Ensembl ID:
ENSDARG00000003877
Description:
polybromo 1 [Source:HGNC Symbol;Acc:30064]
Human Orthologue:
PBRM1
Human Description:
polybromo 1 [Source:HGNC Symbol;Acc:30064]
Mouse Orthologue:
Pbrm1
Mouse Description:
polybromo 1 Gene [Source:MGI Symbol;Acc:MGI:1923998]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27716 Nonsense Mutation detected in F1 DNA During 2017
sa35009 Nonsense Available for shipment Available now
sa41765 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17189 Essential Splice Site Available for shipment Available now
sa31812 Essential Splice Site Available for shipment Available now
sa970 Nonsense Available for shipment Available now
sa31811 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa27716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045971 Nonsense 107 1559 3 28
Genomic Location (Zv9):
Chromosome 11 (position 4013602)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3932106
KASP Assay ID:
2260-3860.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCCATTGATATGATGAAGATCCAGCAGAAGCTGAAGATGGAGGAGTA[T/G]GACGATGTTGAGCAGCTCACAAGCGACTTTCAGCTCTTATTCAGTAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045971 Nonsense 154 1559 4 28
Genomic Location (Zv9):
Chromosome 11 (position 4008638)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3927142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTGTAAACTGTGGGATCTGTATATTCGGACCAAAAACGAGTTTGTG[C/T]AGCGAGGAGACTATGATGAAGATGATGATGATGACGACCCACAGGAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045971 Essential Splice Site 238 1559 6 28
Genomic Location (Zv9):
Chromosome 11 (position 4007067)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3925571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATTAAAGAACCAATCGATCTGAAGAGCATCGCACACCGAATACAGG[T/A]ATTATGATCACATTATTTTACATAATTATATAGAGTATCACTGATCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045971 Essential Splice Site 403 1559 11 28
Genomic Location (Zv9):
Chromosome 11 (position 4001489)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3919993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAATAAGCCTGGGTTGACTGTATGATGACTGACTTGTTTTTTTCWCCA[G/A]GAGTAAGATGAAGAATAATGAGTATGAAAGTGTGGAGCAGATCGACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045971 Essential Splice Site 895 1559 17 28
Genomic Location (Zv9):
Chromosome 11 (position 3991269)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3909773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGTGTTGTGGTGCAGATGCCTGTTGATTATCAATGATTTGACCTGCA[G/A]AGGCAGAAAAGAGCGAGGACACGGCGGGCGGAGGATGGCAGGGAGCCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045971 Nonsense 1232 1559 22 28
Genomic Location (Zv9):
Chromosome 11 (position 3985128)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3903632
KASP Assay ID:
554-0875.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAGGAGGACGTGTTGCTGTGTGAGAGCCGCTACATCGAGAGCGAGAAG[C/T]AAATGAAGAAGTTTAAAGGGCTGAAGCGTTTCTCTYTGTCCGCCAAAGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa31811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045971 Essential Splice Site 1257 1559 22 28
Genomic Location (Zv9):
Chromosome 11 (position 3985050)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3903554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCTCTCTGTCCGCCAAAGTAGTGGAAGATGAAATCTATTACTTCAGG[T/G]CTGTCAACCTGGTCTATCTACTACTAAACGACTCATCTAAAGAAAAAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link