tm9sf2

Ensembl ID:
ENSDARG00000003866
ZFIN ID:
ZDB-GENE-030131-6302
Description:
transmembrane 9 superfamily member 2 [Source:RefSeq peptide;Acc:NP_997893]
Human Orthologue:
TM9SF2
Human Description:
transmembrane 9 superfamily member 2 [Source:HGNC Symbol;Acc:11865]
Mouse Orthologue:
Tm9sf2
Mouse Description:
transmembrane 9 superfamily member 2 Gene [Source:MGI Symbol;Acc:MGI:1915309]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19513 Essential Splice Site Available for shipment Available now
sa18297 Nonsense Available for shipment Available now
sa32695 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019743 Essential Splice Site 52 658 1 17

The following transcripts of ENSDARG00000003866 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 28743676)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAAGAAAGAAGCGGGCGACAAAAACAGCGAAGTCCCAGACTGCAAGG[T/A]AAATATTCACATTTAGAAGTGTACTAAATTAGTTTGCTTAAACGTATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019743 Nonsense 73 658 2 17

The following transcripts of ENSDARG00000003866 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 28746406)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTTGTGAACAGGCTGGATTCTGTGGAGTCAGTTTTACCCTATGAATA[T/A]ACTGCGTGAGTTTAACATGTTTGTCATTTTTTTGTTCATKCAACATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019743 Nonsense 327 658 9 17

The following transcripts of ENSDARG00000003866 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 28754532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAATGGTCGCTATGATCATGCTTCGAACACTTCATAAAGATATCGCT[C/T]GATACAACCAGATGGACTCTGTGGTGAGTTCCACTCTACAAGATTACATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link