chm

Ensembl ID:
ENSDARG00000003845
ZFIN ID:
ZDB-GENE-030318-2
Description:
choroideremia [Source:RefSeq peptide;Acc:NP_982286]
Human Orthologues:
CHM, CHML
Human Descriptions:
choroideremia (Rab escort protein 1) [Source:HGNC Symbol;Acc:1940]
choroideremia-like (Rab escort protein 2) [Source:HGNC Symbol;Acc:1941]
Mouse Orthologues:
Chm, Chml
Mouse Descriptions:
choroideremia-like Gene [Source:MGI Symbol;Acc:MGI:101913]
choroidermia Gene [Source:MGI Symbol;Acc:MGI:892979]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6679 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23994 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005479 Essential Splice Site 108 666 4 15
Genomic Location (Zv9):
Chromosome 21 (position 33676966)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34676659
KASP Assay ID:
554-5232.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCTGTCGATTCTTCTATTTCCAACTTAGAAGTTTTCTGTTATGCCAG[G/A]TTAGGAYTAATTWTGTTTTGCTTACAGTTTGCACAAGTCAAAAACAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005479 Essential Splice Site 301 666 7 15
Genomic Location (Zv9):
Chromosome 21 (position 33684792)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34684485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTACCTTCTGTCTGGACTTTGAGCAGCACCCAGAGGAGTACCAGGG[T/A]ATGACCCCTTGTGTTTGTTTGCCTGCAGCCTTCTGGTTTACATGCTACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link