chm

Ensembl ID:
ENSDARG00000003845
ZFIN ID:
ZDB-GENE-030318-2
Description:
choroideremia [Source:RefSeq peptide;Acc:NP_982286]
Human Orthologues:
CHM, CHML
Human Descriptions:
choroideremia (Rab escort protein 1) [Source:HGNC Symbol;Acc:1940]
choroideremia-like (Rab escort protein 2) [Source:HGNC Symbol;Acc:1941]
Mouse Orthologues:
Chm, Chml
Mouse Descriptions:
choroideremia-like Gene [Source:MGI Symbol;Acc:MGI:101913]
choroidermia Gene [Source:MGI Symbol;Acc:MGI:892979]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6679 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23994 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005479 Essential Splice Site 108 666 4 15
Genomic Location:
Chromosome 21 (position 33676966)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCTGTCGATTCTTCTATTTCCAACTTAGAAGTTTTCTGTTATGCCAG[G/A]TTAGGAYTAATTWTGTTTTGCTTACAGTTTGCACAAGTCAAAAACAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005479 Essential Splice Site 301 666 7 15
Genomic Location:
Chromosome 21 (position 33684792)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTACCTTCTGTCTGGACTTTGAGCAGCACCCAGAGGAGTACCAGGG[T/A]ATGACCCCTTGTGTTTGTTTGCCTGCAGCCTTCTGGTTTACATGCTACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/27tqy11p