si:dkey-162b3.1

Ensembl ID:
ENSDARG00000003829
ZFIN ID:
ZDB-GENE-041111-110
Description:
polypeptide N-acetylgalactosaminyltransferase 2 [Source:RefSeq peptide;Acc:NP_001121823]
Human Orthologue:
GALNT2
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) [Sour
Mouse Orthologue:
Galnt2
Mouse Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 Gene [Source:MGI

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24933 Nonsense Mutation detected in F1 DNA During 2017
sa17374 Nonsense Available for shipment Available now
sa14540 Essential Splice Site Available for shipment Available now
sa12860 Nonsense Available for shipment Available now
sa28108 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021360 Nonsense 21 565 1 16
ENSDART00000136217 Nonsense 21 559 1 16
Genomic Location (Zv9):
Chromosome 13 (position 24442455)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24088115
KASP Assay ID:
554-7488.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAGGATGTATCTATGTTTCGCTGTGCTTTGGGTTCTGGGCATAGCTTA[T/G]TATTTCTATTCGGGAACAACGCTGAGTCGAAAGGTAGGTTTTTCTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021360 Nonsense 35 565 2 16
ENSDART00000136217 Nonsense 35 559 2 16
Genomic Location (Zv9):
Chromosome 13 (position 24363923)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24009583
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGCCTTTTMTGCTCACAATCTGTTCTCCTCTTTGGCAGGATGACTG[G/A]AGTGGCATTAATTCAAACCGAATTCAAACACACAGYAATGCAGATGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021360 Essential Splice Site 290 565 9 16
ENSDART00000136217 Essential Splice Site 290 559 9 16
Genomic Location (Zv9):
Chromosome 13 (position 24310815)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23956475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTGGAACAAAGACRAGCTCGACAAGGAAACCCCATYGCTCCTATCAAG[T/A]AAGAAAGCAATCGTGAAWCTGCTGATGTGTAATTGTCAGCYGCTTTGSGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021360 Nonsense 440 565 14 16
ENSDART00000136217 Nonsense 440 559 14 16
Genomic Location (Zv9):
Chromosome 13 (position 24298155)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23943815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTWGTTTAGAGTGCCGGAWCATCAGGACATTGCATTTGGAGCTCTTCAG[C/T]AGGGTCAAAACTGTCTGGACACACTGGGCCATTTTGCAGATGGTGTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021360 Missense 469 565 14 16
ENSDART00000136217 Essential Splice Site 468 559 None 16
Genomic Location (Zv9):
Chromosome 13 (position 24298067)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23943727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGTGTGGTGGGGGTTTACGAGTGCCACAACGCTGGGGGCAATCAGG[T/A]ATCAAACAAAACGCAGGTACTCAACAGTCTTCTAATGTCTGGTGCAGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hematology traits: Genome-wide association study of serum albumin:globulin ratio in Korean populations. (View Study)
  • Metabolic syndrome: Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits. (View Study)
  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
  • Triglycerides: Newly identified loci that influence lipid concentrations and risk of coronary artery disease. (View Study)
  • Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link