ankrd16

Ensembl ID:
ENSDARG00000003822
ZFIN ID:
ZDB-GENE-041210-253
Description:
ankyrin repeat domain 16 [Source:RefSeq peptide;Acc:NP_001017563]
Human Orthologue:
ANKRD16
Human Description:
ankyrin repeat domain 16 [Source:HGNC Symbol;Acc:23471]
Mouse Orthologue:
Ankrd16
Mouse Description:
ankyrin repeat domain 16 Gene [Source:MGI Symbol;Acc:MGI:2444796]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa939 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa939
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037600 Nonsense 261 368 5 7

The following transcripts of ENSDARG00000003822 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 10526399)
KASP Assay ID:
554-0844.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTCTCGGCGCACAGCCCTTACACCAGGCCTCTGTCACWGCTCAAGAA[G/T]AAGCGCTTTCCTTTCTCGTTCATCATCTTGGCATGGATRTAAACTCAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k8ebmhqj