nr1d2a

Ensembl ID:
ENSDARG00000003820
ZFIN ID:
ZDB-GENE-040504-1
Description:
nuclear receptor subfamily 1, group D, member 2a [Source:RefSeq peptide;Acc:NP_001124064]
Human Orthologue:
NR1D2
Human Description:
nuclear receptor subfamily 1, group D, member 2 [Source:HGNC Symbol;Acc:7963]
Mouse Orthologue:
Nr1d2
Mouse Description:
nuclear receptor subfamily 1, group D, member 2 Gene [Source:MGI Symbol;Acc:MGI:2449205]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18069 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099040 Essential Splice Site 78 504 3 8
ENSDART00000128167 Essential Splice Site 78 505 2 7
Genomic Location (Zv9):
Chromosome 16 (position 53626734)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49896395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAGTGAGCACATCTGACAGGATTTACCGACTCTGACGTGTGTTTTCT[A/G]GAGCTGAATGGGATGGTGYTGCTGTGTAAAGTGTGTGGAGACGTCGCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link