plxnb2a

Ensembl ID:
ENSDARG00000003811
ZFIN ID:
ZDB-GENE-030131-8917
Description:
plexin-B2 [Source:RefSeq peptide;Acc:NP_001155072]
Human Orthologue:
PLXNB2
Human Description:
plexin B2 [Source:HGNC Symbol;Acc:9104]
Mouse Orthologue:
Plxnb2
Mouse Description:
plexin B2 Gene [Source:MGI Symbol;Acc:MGI:2154239]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6934 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6933 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20240 Essential Splice Site Available for shipment Available now
sa17574 Essential Splice Site Available for shipment Available now
sa839 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048821 Essential Splice Site 481 1864 3 35
ENSDART00000143773   None 917 None 21

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 13550424)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14486277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGTTTGATTCAACTTTGAATCACCTGTACATCACCACTGGCAAAAAG[G/A]TTTGCTTATGAACACATTMAYAATGTATAGRTAACGTTWKGTCAACAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048821 Essential Splice Site 782 1864 11 35
ENSDART00000143773   None 917 None 21
Genomic Location (Zv9):
Chromosome 4 (position 13541407)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14477260
KASP Assay ID:
554-5200.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACATAAAGGATAAAGACACGGATAGGAAGATTGACAGCACCCTGAGAGG[T/C]ACATTTAAATGAGTTGTTCTCAGAGCYAAGAAAGCAAATCTTCAAGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20240
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048821 Essential Splice Site 782 1864 12 35
ENSDART00000143773   None 917 None 21
Genomic Location (Zv9):
Chromosome 4 (position 13540021)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14475874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGATGAATTCAGTGTCAGTTCTGTGAATAGTTTTCTTTTCTTTTCCCA[G/T]TGGTTCTCTACAACTGTTCGGTTAGACGCGAGGACTGCAGTCTGTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048821 Essential Splice Site 1281 1864 21 35
ENSDART00000143773 Essential Splice Site 334 917 7 21
Genomic Location (Zv9):
Chromosome 4 (position 13529120)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14464973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCAATTTGGAGGAGAGYGTCCGTGATCGCTGTAAAAAGGAGTTCACAG[G/A]TGAGATCCTAAACTTTTCATATCTGTAGGCTTTTTCTTNCTCAAATAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048821 Essential Splice Site 1758 1864 31 35
ENSDART00000143773 Essential Splice Site 811 917 17 21
Genomic Location (Zv9):
Chromosome 4 (position 13517729)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14453582
KASP Assay ID:
554-0742.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGACCTTCATGGACGCCTGCACTAAAACCGAGCACAAACTGACGCGGG[T/C]GAACAGAAACACTTCATCATTCATCAGCTTCATCAAAACCCTCTCTTCAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link