asb2a

Ensembl ID:
ENSDARG00000003797
ZFIN ID:
ZDB-GENE-030131-5355
Description:
Novel protein similar to vertebrate ankyrin repeat and SOCS box-containing 2 [Source:UniProtKB/TrEMB
Human Orthologue:
ASB2
Human Description:
ankyrin repeat and SOCS box-containing 2 [Source:HGNC Symbol;Acc:16012]
Mouse Orthologue:
Asb2
Mouse Description:
ankyrin repeat and SOCS box-containing 2 Gene [Source:MGI Symbol;Acc:MGI:1929743]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5953 Nonsense Mutation detected in F1 DNA During 2014
sa23721 Nonsense Mutation detected in F1 DNA During 2014
sa8807 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026088 None None 672 None 9
ENSDART00000130533 Nonsense 175 661 3 9
ENSDART00000148361 Nonsense 55 1077 1 14
Genomic Location:
Chromosome 20 (position 27351453)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGCTTCATGAATGTGCCTGCAACGGCCATGTGGASTGCCTTAAGGTTT[T/A]GCTCAAAGGTAAGAAATTAATCATTTGTGTCCAGCTCAGAGTCAAACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026088 None None 672 None 9
ENSDART00000130533 Nonsense 609 661 8 9
ENSDART00000148361 Nonsense 489 1077 6 14
Genomic Location:
Chromosome 20 (position 27347114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTAACCGAACACCTAGACAACAACAAAGACTGGGCTCATGTAAAAGAA[A/T]AAGCAGGTGAGAACATTCTTTGTAATTCTTCTTCTATTCTTTTCATTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026088 Essential Splice Site 194 672 3 9
ENSDART00000130533 None None 661 None 9
ENSDART00000148361 None None 1077 None 14
Genomic Location:
Chromosome 20 (position 27336087)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGCGGCATATTATGGACAAGATCAATGCGTTAAAATTCTCCTGAGAG[G/A]TAGAGTGCACTYATTTRTAAATTCCTCAAATCCWAWTTTCCAAGCTGTRA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i0n2upnh