IDH2

Ensembl ID:
ENSDARG00000003795
Description:
isocitrate dehydrogenase 2 (NADP+), mitochondrial [Source:HGNC Symbol;Acc:5383]
Human Orthologue:
IDH2
Human Description:
isocitrate dehydrogenase 2 (NADP+), mitochondrial [Source:HGNC Symbol;Acc:5383]
Mouse Orthologue:
Idh2
Mouse Description:
isocitrate dehydrogenase 2 (NADP+), mitochondrial Gene [Source:MGI Symbol;Acc:MGI:96414]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13876 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004692 Nonsense 37 447 2 16
Genomic Location:
Chromosome 18 (position 25893928)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATRGAAAAACTGGCTTGTAAGAATAATTAGTTTTTGTWTTATTTGACAGA[T/A]GCCGATAAACGTATCCAGGTGGCACAGCCGGTGGTGGAGATGGATGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4ympal31