dennd5b

Ensembl ID:
ENSDARG00000003789
ZFIN ID:
ZDB-GENE-030131-2248
Description:
DENN domain-containing protein 5B [Source:UniProtKB/Swiss-Prot;Acc:Q6NXD8]
Human Orthologue:
DENND5B
Human Description:
DENN/MADD domain containing 5B [Source:HGNC Symbol;Acc:28338]
Mouse Orthologue:
Dennd5b
Mouse Description:
DENN/MADD domain containing 5B Gene [Source:MGI Symbol;Acc:MGI:2444273]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31391 Nonsense Available for shipment Available now
sa10610 Essential Splice Site Available for shipment Available now
sa11630 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033053 Nonsense 555 1311 6 22
ENSDART00000079461 Nonsense 555 1325 6 23
ENSDART00000133837   None 152 None 5
ENSDART00000140510 Nonsense 535 1291 5 21
ENSDART00000141119   None 240 None 4
Genomic Location (Zv9):
Chromosome 4 (position 15740641)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16683481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGAGGGAGGTGTTCGCCGCACGCTTCGCAACGATGTTTGCAGACTA[C/A]GAGTCGTTTGTGATTCAGAACTCGCCAGATTTGGAGTCTTGGCTGACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10610
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033053 Essential Splice Site 888 1311 13 22
ENSDART00000079461 Essential Splice Site 888 1325 13 23
ENSDART00000133837   None 152 None 5
ENSDART00000140510 Essential Splice Site 868 1291 12 21
ENSDART00000141119   None 240 None 4
Genomic Location (Zv9):
Chromosome 4 (position 15727817)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16670657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCGTTGGTCTTCCTGGATTACGTGTGTCCGTCATACAGGATATGAGG[T/A]TTGTTTATCACTKGATGGCGTATTACAGGGGTTTGGTTTTATAATAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033053 Essential Splice Site 972 1311 16 22
ENSDART00000079461 Essential Splice Site 972 1325 16 23
ENSDART00000133837 Essential Splice Site 28 152 2 5
ENSDART00000140510 Essential Splice Site 952 1291 15 21
ENSDART00000141119   None 240 None 4
Genomic Location (Zv9):
Chromosome 4 (position 15725955)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16668795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAACATTTTGTTTAGTTTCCACCTAATTTGTGTTGTTTTCGCATTGTAA[G/A]TGATCCCATACCGGGCTGTGAKCATCCCCATCAAGAAGCTGAGTAACGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link