NP_571883.1

Ensembl ID:
ENSDARG00000003783
Description:
ephrin B2b [Source:RefSeq peptide;Acc:NP_571883]
Human Orthologue:
EFNB2
Human Description:
ephrin-B2 [Source:HGNC Symbol;Acc:3227]
Mouse Orthologue:
Efnb2
Mouse Description:
ephrin B2 Gene [Source:MGI Symbol;Acc:MGI:105097]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu2971 Nonsense Confirmed mutation in F2 line Unknown
sa25519 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
hu2971
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023180 Nonsense 78 334 2 5
Genomic Location (Zv9):
Chromosome 1 (position 6783557)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 6966774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAAGCCAGGCTCCACTGAGCAGACGAACATTGAATACTTCCGGGTCTA[T/A]CTTGTTCCCAAAGAACAACTCGAGACCTGCCATGTTACTAAAAGCGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023180 Nonsense 131 334 2 5
Genomic Location (Zv9):
Chromosome 1 (position 6783716)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 6966615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTCAGCCCCAACCTGTGGGGCCTGGAGTTCTTAAGAGGGAAGGACTA[T/G]CACATCATCTGTAAGTTTATTGCCACTCTCATTCAAGAATTTACCTCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link