ctnnd2b

Ensembl ID:
ENSDARG00000003779
ZFIN ID:
ZDB-GENE-070912-532
Description:
catenin delta-2 [Source:RefSeq peptide;Acc:NP_001180580]
Human Orthologue:
CTNND2
Human Description:
catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein) [Sour
Mouse Orthologue:
Ctnnd2
Mouse Description:
catenin (cadherin associated protein), delta 2 Gene [Source:MGI Symbol;Acc:MGI:1195966]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6847 Nonsense Mutation detected in F1 DNA During 2016
sa19788 Nonsense Mutation detected in F1 DNA During 2016
sa32942 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087270 Nonsense 185 1207 5 22
ENSDART00000090292 Nonsense 185 1210 6 22
ENSDART00000110798 Nonsense 185 794 6 14
ENSDART00000142500   None 268 None 5
ENSDART00000145405   None 114 None 5
Genomic Location:
Chromosome 2 (position 30332945)
KASP Assay ID:
554-4420.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCTCARCCGCCTCGCAGTGGTCAGGTGGGAGGAGCCTTACATAGCTA[T/A]AATCAGGTGGGGATTCATYGCTTYGGAAAAACNCTGACACTTTTAAAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087270 Nonsense 258 1207 6 22
ENSDART00000090292 Nonsense 258 1210 7 22
ENSDART00000110798 Nonsense 258 794 7 14
ENSDART00000142500   None 268 None 5
ENSDART00000145405   None 114 None 5
Genomic Location:
Chromosome 2 (position 30329104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGAGCTCTCCCTTTTCCATGCAGGCTTTGGGCTCCCCCTCCAAACTG[C/T]AGAGGCTGGGCTCAGCCTCTGACATGCCCAGCTATGCCACTCTGGCGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087270 Nonsense 276 1207 6 22
ENSDART00000090292 Nonsense 276 1210 7 22
ENSDART00000110798 Nonsense 276 794 7 14
ENSDART00000142500   None 268 None 5
ENSDART00000145405   None 114 None 5
Genomic Location:
Chromosome 2 (position 30329049)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGGCTCAGCCTCTGACATGCCCAGCTATGCCACTCTGGCGCGGGTGT[C/A]GTCGCCCAAGCAGTCCCCCAGCCGGCTGGCCAAATCCTACAGCACGAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link