ctnnd2b

Ensembl ID:
ENSDARG00000003779
ZFIN ID:
ZDB-GENE-070912-532
Description:
catenin delta-2 [Source:RefSeq peptide;Acc:NP_001180580]
Human Orthologue:
CTNND2
Human Description:
catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein) [Sour
Mouse Orthologue:
Ctnnd2
Mouse Description:
catenin (cadherin associated protein), delta 2 Gene [Source:MGI Symbol;Acc:MGI:1195966]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6847 Nonsense Mutation detected in F1 DNA During 2014
sa19788 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087270 Nonsense 185 1207 5 22
ENSDART00000090292 Nonsense 185 1210 6 22
ENSDART00000110798 Nonsense 185 794 6 14
ENSDART00000142500 None None 268 None 5
ENSDART00000145405 None None 114 None 5
Genomic Location:
Chromosome 2 (position 30332945)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCTCARCCGCCTCGCAGTGGTCAGGTGGGAGGAGCCTTACATAGCTA[T/A]AATCAGGTGGGGATTCATYGCTTYGGAAAAACNCTGACACTTTTAAAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087270 Nonsense 258 1207 6 22
ENSDART00000090292 Nonsense 258 1210 7 22
ENSDART00000110798 Nonsense 258 794 7 14
ENSDART00000142500 None None 268 None 5
ENSDART00000145405 None None 114 None 5
Genomic Location:
Chromosome 2 (position 30329104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGAGCTCTCCCTTTTCCATGCAGGCTTTGGGCTCCCCCTCCAAACTG[C/T]AGAGGCTGGGCTCAGCCTCTGACATGCCCAGCTATGCCACTCTGGCGCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vjbl5mqv