NP_001122174.1

Ensembl ID:
ENSDARG00000003776
Description:
hypothetical protein LOC560360 [Source:RefSeq peptide;Acc:NP_001122174]
Human Orthologue:
PIP4K2A
Human Description:
phosphatidylinositol-5-phosphate 4-kinase, type II, alpha [Source:HGNC Symbol;Acc:8997]
Mouse Orthologue:
Pip4k2a
Mouse Description:
phosphatidylinositol-5-phosphate 4-kinase, type II, alpha Gene [Source:MGI Symbol;Acc:MGI:1298206]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44114 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014787 Essential Splice Site 47 404 1 10
Genomic Location (Zv9):
Chromosome 24 (position 17618861)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16925337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCGACCCTCTGCTCAGTGTTCTCATGTGGGGAATTAACCATTCGG[T/G]GAGTGAAATCTGCAGCCTTTTCCTTTGTGTTTGTGTCCGTTATTGATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link