lats1

Ensembl ID:
ENSDARG00000003751
ZFIN ID:
ZDB-GENE-050523-2
Description:
serine/threonine-protein kinase LATS1 [Source:RefSeq peptide;Acc:NP_001018346]
Human Orthologue:
LATS1
Human Description:
LATS, large tumor suppressor, homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:6514]
Mouse Orthologue:
Lats1
Mouse Description:
large tumor suppressor Gene [Source:MGI Symbol;Acc:MGI:1333883]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36934 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027119 Essential Splice Site 119 1068 None 8
ENSDART00000081949 Essential Splice Site 119 1105 None 9
ENSDART00000109321 Essential Splice Site 119 632 None 6
Genomic Location (Zv9):
Chromosome 20 (position 1288460)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1244325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAGCAGCAAACACACACTCCAGACGCAGGAGCCCGGCTTTGATGAGG[T/C]AATGCAGCTGGTTGAGTTTTAAAGGGGCAGTTCACGCAAACATGAAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link