lats1

Ensembl ID:
ENSDARG00000003751
ZFIN ID:
ZDB-GENE-050523-2
Description:
serine/threonine-protein kinase LATS1 [Source:RefSeq peptide;Acc:NP_001018346]
Human Orthologue:
LATS1
Human Description:
LATS, large tumor suppressor, homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:6514]
Mouse Orthologue:
Lats1
Mouse Description:
large tumor suppressor Gene [Source:MGI Symbol;Acc:MGI:1333883]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4877 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027119 Nonsense 266 1068 3 8
ENSDART00000081949 Nonsense 266 1105 3 9
ENSDART00000109321 Nonsense 266 632 4 6
Genomic Location:
Chromosome 20 (position 1281138)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTGCCCCGGATCTCCCCAGTGCCCCAAGGCCCTCGAGGTGATGGCTA[T/G]ATAAAYCCTCAGTCCCAAAATCAGCGCGGGCTCAGCCCGGTGCCGGTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mmk7bn8f