si:dkey-183n20.16

Ensembl ID:
ENSDARG00000003750
ZFIN ID:
ZDB-GENE-030131-4420
Description:
phosphoribosylformylglycinamidine synthase [Source:RefSeq peptide;Acc:NP_001038667]
Human Orthologue:
PFAS
Human Description:
phosphoribosylformylglycinamidine synthase [Source:HGNC Symbol;Acc:8863]
Mouse Orthologue:
Pfas
Mouse Description:
phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) Gene [Source:MGI Symbol;Acc:MGI:2

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23705 Essential Splice Site Available for shipment Available now
sa37025 Nonsense Mutation detected in F1 DNA During 2017
sa37026 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012581 Essential Splice Site 121 1314 4 29
Genomic Location (Zv9):
Chromosome 20 (position 25478078)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25549381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGAGTCAGGTGACGAGAGTCGAGCTCTCCCGCAGACATCTCATCAAG[G/A]TTAGGAGAGCAGCTTTAAATAGACTTACATTACAGTTTTTTCCCTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012581 Nonsense 580 1314 15 29
Genomic Location (Zv9):
Chromosome 20 (position 25489255)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25560558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCCCTCTGACCGGAGCTTCCTAGAGAGGGTCTGTCAGAGGGAAAAGTG[T/A]CCTGTCGACTTTGTGGGCAAGATAACTGGTGATGGCAAGGTGAGTCGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012581 Nonsense 1300 1314 29 29
Genomic Location (Zv9):
Chromosome 20 (position 25501691)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25572994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCTTGGGCTCCTCAGCACCTCAGGGGCTCATTGGAGCCATCACCGTG[G/A]CTTAGCATGTTCCGAAACGCAGCAGCCTGGTGCCAGAATTCATAGAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link