polb

Ensembl ID:
ENSDARG00000003749
ZFIN ID:
ZDB-GENE-040830-1
Description:
DNA polymerase beta [Source:UniProtKB/Swiss-Prot;Acc:Q6DRD3]
Human Orthologue:
POLB
Human Description:
polymerase (DNA directed), beta [Source:HGNC Symbol;Acc:9174]
Mouse Orthologue:
Polb
Mouse Description:
polymerase (DNA directed), beta Gene [Source:MGI Symbol;Acc:MGI:97740]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15883 Nonsense Available for shipment Available now
sa696 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002764 Nonsense 4 339 1 14
ENSDART00000133938 Nonsense 4 291 1 13

The following transcripts of ENSDARG00000003749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 2632066)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2398455
KASP Assay ID:
2260-0042.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAASTTMTTATCCTTTAAAGGGTCAAGCTATTGTTTAATATGAGTAAA[C/T]GAAAAGCGCCACAAGAATCCCTGAACGAAGGAATCACTGATTTTCTYGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002764 Essential Splice Site 107 339 6 14
ENSDART00000133938 Essential Splice Site 116 291 6 13

The following transcripts of ENSDARG00000003749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 2636723)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2403112
KASP Assay ID:
554-0604.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACATTAGTGTTGTCTAAAACTTAATACACACTCATTCTGTCTTATTTC[A/G]GTCCTGCTGCCGCCAGGAAGTTTTTTGACGAGGGCGTCAGGAATTTAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link