prnprs3

Ensembl ID:
ENSDARG00000003705
ZFIN ID:
ZDB-GENE-041221-3
Description:
prion protein, related sequence 3 [Source:RefSeq peptide;Acc:NP_001013316]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37986 Nonsense Mutation detected in F1 DNA During 2017
sa15677 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116357 Nonsense 255 481 2 3
Genomic Location (Zv9):
Chromosome 25 (position 3738705)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3556630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGTATCCAAACTGGAACCCCAACAATAAAATCATGAGCCCAGCCTA[T/A]GGCGGCAACTATGGTGGTTACGGATATGGTGGCAGATCACCTTTCGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15677
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116357 Nonsense 384 481 2 3
Genomic Location (Zv9):
Chromosome 25 (position 3739092)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3557017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAATCTTAAYCCTCATGAAATCTTCCAGAATCCTCCTCCTCAGTCCTA[T/A]GACAAGTTTATGGACACGTGTATGAAGAGGACAGATTTGCTCAGAGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link