atp7a

Ensembl ID:
ENSDARG00000003699
ZFIN ID:
ZDB-GENE-060825-45
Description:
copper-transporting ATPase 1 [Source:RefSeq peptide;Acc:NP_001036185]
Human Orthologue:
ATP7A
Human Description:
ATPase, Cu++ transporting, alpha polypeptide [Source:HGNC Symbol;Acc:869]
Mouse Orthologue:
Atp7a
Mouse Description:
ATPase, Cu++ transporting, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:99400]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35686 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42389 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17337 Nonsense Available for shipment Available now
sa35687 Nonsense Mutation detected in F1 DNA During 2016
sa38992 Nonsense Mutation detected in F1 DNA During 2016
sa22467 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Essential Splice Site None 1500 1 23
ENSDART00000124072   None 1483 None 22
ENSDART00000128097 Essential Splice Site None 208 1 3
Genomic Location (Zv9):
Chromosome 14 (position 23400657)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22100447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATTAAACTTGTTGGTCCTGTGACTCAGCATCAGCTCTTCGCACGAAAG[G/A]TAAAACAATCCAGCAGTTTTGTTGTTCTTCGTGTCTGTGGTTTAAGTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Essential Splice Site 40 1500 2 23
ENSDART00000124072 Essential Splice Site 41 1483 1 22
ENSDART00000128097 Essential Splice Site 40 208 2 3
Genomic Location (Zv9):
Chromosome 14 (position 23403581)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22103371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCATTGAAGGCCGGATCGGAGGCCTGCCAGGAGTCATTCATATACAG[G/A]TTAGAGATATGGATGTCAGTTACACCAAGTGAACTCTTAAGAATAAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 680 1500 9 23
ENSDART00000124072 Nonsense 681 1483 8 22
ENSDART00000128097   None 208 None 3
Genomic Location (Zv9):
Chromosome 14 (position 23423574)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22123364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAGYATCATCAANNNCATAACGCCACCGCTGAGGACAGAGCGAAATA[T/G]CACTCCACAATGTTYCTGGAGAAACAGCTTCTGCCAGGCCTCTCCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 917 1500 14 23
ENSDART00000124072 Nonsense 918 1483 13 22
ENSDART00000128097   None 208 None 3
Genomic Location (Zv9):
Chromosome 14 (position 23430974)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22130764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGTCTAAATAAACTTTTTTCATTTAACGATTTCAGGCTCCCATCCAG[C/T]AGTTTGCAGATAAAATCAGTAGCTACTTTGTCCCGTTCATCGTTGTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 1088 1500 17 23
ENSDART00000124072 Nonsense 1089 1483 16 22
ENSDART00000128097   None 208 None 3
Genomic Location (Zv9):
Chromosome 14 (position 23434638)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22134428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGCATTTGGATTCACAAAGCGTCTTCTGTGTTTAGGAGTTGGGGACA[G/T]AGTCTCTTGGCACTTGCACAGATTTTCAAGCTGTGCCAGGTTGTGGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 1498 1500 23 23
ENSDART00000124072 Nonsense 1481 1483 22 22
ENSDART00000128097   None 208 None 3
Genomic Location (Zv9):
Chromosome 14 (position 23442121)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22141911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAACCCGACAAACACTCTCTACTGGTGGGAGACGATCACTGCGACAAC[G/T]AGATAGTCTGAGGGTCTCTGGAGCTTCGCTTTACCGCAGTGCCTGCAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link