atp7a

Ensembl ID:
ENSDARG00000003699
ZFIN ID:
ZDB-GENE-060825-45
Description:
copper-transporting ATPase 1 [Source:RefSeq peptide;Acc:NP_001036185]
Human Orthologue:
ATP7A
Human Description:
ATPase, Cu++ transporting, alpha polypeptide [Source:HGNC Symbol;Acc:869]
Mouse Orthologue:
Atp7a
Mouse Description:
ATPase, Cu++ transporting, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:99400]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17337 Nonsense Available for shipment Available now
sa22467 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 680 1500 9 23
ENSDART00000124072 Nonsense 681 1483 8 22
ENSDART00000128097 None None 208 None 3
Genomic Location:
Chromosome 14 (position 23423574)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAGYATCATCAANNNCATAACGCCACCGCTGAGGACAGAGCGAAATA[T/G]CACTCCACAATGTTYCTGGAGAAACAGCTTCTGCCAGGCCTCTCCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 1498 1500 23 23
ENSDART00000124072 Nonsense 1481 1483 22 22
ENSDART00000128097 None None 208 None 3
Genomic Location:
Chromosome 14 (position 23442121)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAACCCGACAAACACTCTCTACTGGTGGGAGACGATCACTGCGACAAC[G/T]AGATAGTCTGAGGGTCTCTGGAGCTTCGCTTTACCGCAGTGCCTGCAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zm7bwna9