atp7a

Ensembl ID:
ENSDARG00000003699
ZFIN ID:
ZDB-GENE-060825-45
Description:
copper-transporting ATPase 1 [Source:RefSeq peptide;Acc:NP_001036185]
Human Orthologue:
ATP7A
Human Description:
ATPase, Cu++ transporting, alpha polypeptide [Source:HGNC Symbol;Acc:869]
Mouse Orthologue:
Atp7a
Mouse Description:
ATPase, Cu++ transporting, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:99400]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17337 Nonsense Available for shipment Available now
sa22467 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa17337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 680 1500 9 23
ENSDART00000124072 Nonsense 681 1483 8 22
ENSDART00000128097   None 208 None 3
Genomic Location:
Chromosome 14 (position 23423574)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAGYATCATCAANNNCATAACGCCACCGCTGAGGACAGAGCGAAATA[T/G]CACTCCACAATGTTYCTGGAGAAACAGCTTCTGCCAGGCCTCTCCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 1498 1500 23 23
ENSDART00000124072 Nonsense 1481 1483 22 22
ENSDART00000128097   None 208 None 3
Genomic Location:
Chromosome 14 (position 23442121)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAACCCGACAAACACTCTCTACTGGTGGGAGACGATCACTGCGACAAC[G/T]AGATAGTCTGAGGGTCTCTGGAGCTTCGCTTTACCGCAGTGCCTGCAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zm7bwna9