obsl1a

Ensembl ID:
ENSDARG00000003684
ZFIN ID:
ZDB-GENE-060503-649
Description:
hypothetical protein LOC796577 [Source:RefSeq peptide;Acc:NP_001121829]
Human Orthologue:
OBSL1
Human Description:
obscurin-like 1 [Source:HGNC Symbol;Acc:29092]
Mouse Orthologue:
Obsl1
Mouse Description:
obscurin-like 1 Gene [Source:MGI Symbol;Acc:MGI:2138628]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14871 Nonsense Available for shipment Available now
sa20691 Nonsense Mutation detected in F1 DNA During 2016
sa25336 Nonsense Mutation detected in F1 DNA During 2016
sa33864 Nonsense Mutation detected in F1 DNA During 2016
sa11178 Nonsense Available for shipment Available now
sa33863 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33862 Nonsense Mutation detected in F1 DNA During 2016
sa9215 Nonsense Mutation detected in F1 DNA During 2016
sa25335 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102838 Nonsense 133 1879 2 22
ENSDART00000126782   None 886 None 12
ENSDART00000137136 Nonsense 155 2006 1 21
Genomic Location (Zv9):
Chromosome 6 (position 22873165)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19128611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAAAGAAAAAAGACCCATTCCAAGATARCAAGCCTTATTTTTTGATC[A/T]AACCACTTTCCCTGAGAGTAGATCGTGGAGAAGATGCTGCCTTCTCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102838 Nonsense 693 1879 7 22
ENSDART00000126782   None 886 None 12
ENSDART00000137136 Nonsense 730 2006 5 21
Genomic Location (Zv9):
Chromosome 6 (position 22858625)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19114071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAAATGTGTATGATGGAGCTGAAATCACTTTTATTGCCACTGGTGTA[C/T]GAGATTCAGCATCCCTACAGATTAAAGGTCAGCATTCGTGTGGATGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102838 Nonsense 831 1879 9 22
ENSDART00000126782   None 886 None 12
ENSDART00000137136 Nonsense 960 2006 8 21
Genomic Location (Zv9):
Chromosome 6 (position 22856764)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19112210
KASP Assay ID:
554-7533.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATAGTCCTAAACTGTGAGCTCTCTCGATCTAATGGAGAGGTTCAGTG[G/A]TTTAAAGATGGCCTAAAGCTCCAAGAGACTGACAATATTCGCCTCAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102838 Nonsense 1079 1879 12 22
ENSDART00000126782   None 886 None 12
ENSDART00000137136 Nonsense 1208 2006 11 21
Genomic Location (Zv9):
Chromosome 6 (position 22854105)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19109551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTTTTTTTCTCTCTTACAGAGGCACCAGTAACAATCCTGAATAAAGAT[C/T]AAATCAAGAATGAGCACAAAGTTATGTTATATGATGATGTTGTAATGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102838 Nonsense 1149 1879 12 22
ENSDART00000126782   None 886 None 12
ENSDART00000137136 Nonsense 1278 2006 11 21
Genomic Location (Zv9):
Chromosome 6 (position 22853895)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19109341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTCTCTGTGMGGAGCTGCARGACTCWGGAGAATATACGCTTGATGCT[A/T]AAAATGATACATTTTCAKTTCATGTCACAGTACAAGGTAAACAAAAAATK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102838 Essential Splice Site 1253 1879 13 22
ENSDART00000126782 Essential Splice Site 263 886 3 12
ENSDART00000137136 Essential Splice Site 1382 2006 12 21
Genomic Location (Zv9):
Chromosome 6 (position 22853490)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19108936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGTGATGCTGTAGATGACAAGATGCTAACTGTTGTTAAAGTTCAAGG[T/C]ATTCTATTTTCTTTGCTTTATACAATTTCAAACTGCTAATTAAAACTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102838 Nonsense 1290 1879 14 22
ENSDART00000126782   None 886 None 12
ENSDART00000137136   None 2006 None 21
Genomic Location (Zv9):
Chromosome 6 (position 22852772)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19108218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTCACCTTGACTGCCATGGTTTCCAGACCCAATGCTCAAGTGAGGTG[G/A]CTTAAAGACTGGACTCAAATCAGCGGAGAACGATTCCACACAGCTAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102838 Nonsense 1633 1879 18 22
ENSDART00000126782 Nonsense 553 886 7 12
ENSDART00000137136 Nonsense 1672 2006 16 21
Genomic Location (Zv9):
Chromosome 6 (position 22846996)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19102442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTAAGAAGTTGWCTGATGTCAGAATTGAGGAGGAATCTTCAGTCGTTT[T/A]GGAGTGCGAGTTGTCTAGRCCAAATGTGGATGTCAGATGGCAAAAGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102838 Essential Splice Site 1700 1879 20 22
ENSDART00000126782 Essential Splice Site 620 886 9 12
ENSDART00000137136 Essential Splice Site 1739 2006 18 21
Genomic Location (Zv9):
Chromosome 6 (position 22846112)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19101558
KASP Assay ID:
554-7287.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATTCCAATTTTAAGAACCCACATTTGTACTTTCTCTAAATTATTTTC[A/T]GAACATGAATTAGAACTCATAACTGGCTTGGAGGATCTTTGGATTAAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link