LOC100330423

Ensembl ID:
ENSDARG00000003682
Human Orthologue:
C12orf51
Human Description:
chromosome 12 open reading frame 51 [Source:HGNC Symbol;Acc:26611]
Mouse Orthologue:
Gm15800
Mouse Description:
predicted gene 15800 Gene [Source:MGI Symbol;Acc:MGI:3647820]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30896 Nonsense Mutation detected in F1 DNA During 2015
sa21158 Nonsense Mutation detected in F1 DNA During 2015
sa11121 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086005 Nonsense 578 1619 8 23
Genomic Location:
Chromosome 7 (position 75690788)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATCAGAATGCGACAATGCTCTATTAAACATGAAGCCTGAAGACATGT[T/A]GTGGTTTCACCGGGGGTTGACCTTGCTTTTGATTTTACGGCATCTTACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086005 Nonsense 588 1619 8 23
Genomic Location:
Chromosome 7 (position 75690818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAAGCCTGAAGACATGTTGTGGTTTCACCGGGGGTTGACCTTGCTTT[T/A]GATTTTACGGCATCTTACTAATAAGGACCCGCAAGGTCTTGGCGTCACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086005 Nonsense 1442 1619 21 23
Genomic Location:
Chromosome 7 (position 75713830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNTGTGTGTGTGTCTGTGTGTGTTAAGCTGGGAGAATAAGGATGTGTA[T/A]GTGCGAGCGGTGCGTGAGCTGCGTCTGCGGGAGCTGCAGAATGTGGAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mt02hv9a