LOC100330423

Ensembl ID:
ENSDARG00000003682
Human Orthologue:
C12orf51
Human Description:
chromosome 12 open reading frame 51 [Source:HGNC Symbol;Acc:26611]
Mouse Orthologue:
Gm15800
Mouse Description:
predicted gene 15800 Gene [Source:MGI Symbol;Acc:MGI:3647820]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21158 Nonsense Mutation detected in F1 DNA During 2014
sa11121 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086005 Nonsense 588 1619 8 23
Genomic Location:
Chromosome 7 (position 75690818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAAGCCTGAAGACATGTTGTGGTTTCACCGGGGGTTGACCTTGCTTT[T/A]GATTTTACGGCATCTTACTAATAAGGACCCGCAAGGTCTTGGCGTCACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086005 Nonsense 1442 1619 21 23
Genomic Location:
Chromosome 7 (position 75713830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNTGTGTGTGTGTCTGTGTGTGTTAAGCTGGGAGAATAAGGATGTGTA[T/A]GTGCGAGCGGTGCGTGAGCTGCGTCTGCGGGAGCTGCAGAATGTGGAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mt02hv9a