runx1t1

Ensembl ID:
ENSDARG00000003680
ZFIN ID:
ZDB-GENE-060929-164
Description:
protein CBFA2T1 [Source:RefSeq peptide;Acc:NP_001070244]
Human Orthologue:
RUNX1T1
Human Description:
runt-related transcription factor 1; translocated to, 1 (cyclin D-related) [Source:HGNC Symbol;Acc:1
Mouse Orthologue:
Runx1t1
Mouse Description:
runt-related transcription factor 1; translocated to, 1 (cyclin D-related) Gene [Source:MGI Symbol;A

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29233 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010294 Splice Site, Nonsense 56 588 3 11
ENSDART00000123270 Splice Site, Nonsense 39 311 3 6
ENSDART00000125645 Splice Site, Nonsense 65 597 2 10
ENSDART00000147226 Splice Site, Nonsense 56 588 5 13
Genomic Location (Zv9):
Chromosome 19 (position 35120568)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 34168774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCGTTCTCTTTGTGGTGTGTGGAAATAATCATCGTTCTGTTTTCCAG[T/A]AACGAATGGCACCAGTCACTCTCCCACTGCACTAAATGGAGCTCCATCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link