clock3

Ensembl ID:
ENSDARG00000003631
ZFIN ID:
ZDB-GENE-030408-2
Description:
clock homolog 3 [Source:RefSeq peptide;Acc:NP_840080]
Human Orthologue:
CLOCK
Human Description:
clock homolog (mouse) [Source:HGNC Symbol;Acc:2082]
Mouse Orthologue:
Clock
Mouse Description:
circadian locomotor output cycles kaput Gene [Source:MGI Symbol;Acc:MGI:99698]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17700 Essential Splice Site Available for shipment Available now
sa32647 Essential Splice Site Mutation detected in F1 DNA During 2016
sa386 Nonsense Available for shipment Available now
sa19471 Nonsense Available for shipment Available now
sa32648 Nonsense Available for shipment Available now
sa1868 Nonsense Available for shipment Available now
sa24840 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012552   None 814 None 21
ENSDART00000103119   None 820 None 20
ENSDART00000133959 Essential Splice Site None 820 None 21

The following transcripts of ENSDARG00000003631 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18176091)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18741259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTAAACTGTTAAATTATCACTGGCTTAWCTTCTRTTTTTTATGTCTGC[A/G]GACGTTCACATTGGCAGGTCCTCYTCACCAATGTCTTCCCAACGTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012552 Essential Splice Site 75 814 3 21
ENSDART00000103119 Essential Splice Site 75 820 3 20
ENSDART00000133959 Essential Splice Site 75 820 4 21

The following transcripts of ENSDARG00000003631 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18179462)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18744630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTCTACGATTTTGCAAAAAAGCATAGACTACCTGCGCAAGAACAAAG[G/A]TGAGGCAAGAAATCATTTATGTTTTGTTTCACAATGTGTATTATAGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012552 Nonsense 123 814 5 21
ENSDART00000103119 Nonsense 123 820 5 20
ENSDART00000133959 Nonsense 123 820 6 21

The following transcripts of ENSDARG00000003631 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18182013)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18747181
KASP Assay ID:
554-0247.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTGGATGGATTCTTCCTCGTGATGCTGACAGATGGATATATCATTTA[C/A]ATCTCAGAAAGCGTAACCTCTTTACTGGAGCATCTTCCTGTAAGTGAGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa19471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012552 Nonsense 199 814 7 21
ENSDART00000103119 Nonsense 199 820 7 20
ENSDART00000133959 Nonsense 199 820 8 21

The following transcripts of ENSDARG00000003631 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18185897)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18751065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGTCACATGCTCAGAGGTTCTGTGGATCCCAAGAAACCGCCTGTATA[T/G]GAATATGTTAAGTTTATCGGCAACTTTAAGTCACTTGTCAACAGTAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012552 Nonsense 498 814 15 21
ENSDART00000103119 Nonsense 498 820 15 20
ENSDART00000133959 Nonsense 498 820 16 21

The following transcripts of ENSDARG00000003631 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18196786)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18761954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGTCCAAATCAGCCAACAAACACAACATCAACAACAACAACCTCAA[C/T]AACCACAGCAGGTTCAGCCTAATGCTTTGGTGAGTCTTTTATTATTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012552 Nonsense 712 814 19 21
ENSDART00000103119 Nonsense 712 820 19 20
ENSDART00000133959 Nonsense 712 820 20 21

The following transcripts of ENSDARG00000003631 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18203963)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18769131
KASP Assay ID:
554-1859.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGATGTTTATGGGTCAGGTGGTGACCGCGTACAGTCCGTTTACACARCAA[C/T]AGGGTCAGACGCAGACCATAACACTGCAGACGCAGCCCACCGTGCCTGCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa24840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012552 Nonsense 786 814 20 21
ENSDART00000103119 Nonsense 786 820 20 20
ENSDART00000133959 Nonsense 786 820 21 21

The following transcripts of ENSDARG00000003631 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18207847)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18773015
KASP Assay ID:
554-7815.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGATCCTGCAGGCTTTCCCTATTCAGCAGCAGAGCACATTTACTCCAT[C/A]ACAACAACAACAACAACAGCAGCAACTGAAACCACACACTCAGAAACCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link