nr2f6a

Ensembl ID:
ENSDARG00000003607
ZFIN ID:
ZDB-GENE-030131-4362
Description:
nuclear receptor subfamily 2, group F, member 6 [Source:RefSeq peptide;Acc:NP_991120]
Human Orthologue:
NR2F6
Human Description:
nuclear receptor subfamily 2, group F, member 6 [Source:HGNC Symbol;Acc:7977]
Mouse Orthologue:
Nr2f6
Mouse Description:
nuclear receptor subfamily 2, group F, member 6 Gene [Source:MGI Symbol;Acc:MGI:1352453]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19746 Essential Splice Site Available for shipment Available now
sa39819 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022379 Essential Splice Site 122 402 3 5
ENSDART00000133818   None 88 None 2
ENSDART00000135323 Essential Splice Site 113 243 2 3
Genomic Location (Zv9):
Chromosome 2 (position 23487358)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24721137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATACTGCCGTTTAAAGAAGTGTTTCCGAGTGGGAATGCGTAAAGAAGG[T/C]AATTGTTTGATGCAAACACACTGATTTGTCAACGTAATATTAGATGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022379 Nonsense 180 402 4 5
ENSDART00000133818   None 88 None 2
ENSDART00000135323 Nonsense 170 243 3 3
Genomic Location (Zv9):
Chromosome 2 (position 23482328)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24726167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCCAGCTCCTGCGGGCAGAGCCTTACCCTAACAGCCGCTACAGCCAC[C/T]AGTACAACCAGCAGATGCAAGGCGGTGGTGGCGGTGGATCTGGCATGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link