rpl3

Ensembl ID:
ENSDARG00000003599
ZFIN ID:
ZDB-GENE-030131-1291
Description:
60S ribosomal protein L3 [Source:RefSeq peptide;Acc:NP_001001590]
Human Orthologues:
AC096766.1, RPL3
Human Description:
ribosomal protein L3 [Source:HGNC Symbol;Acc:10332]
Mouse Orthologues:
Gm5879, Rpl3
Mouse Descriptions:
predicted gene 5879 Gene [Source:MGI Symbol;Acc:MGI:3647624]
ribosomal protein L3 Gene [Source:MGI Symbol;Acc:MGI:1351605]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20025 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16344 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011251 Essential Splice Site 283 403 6 9
ENSDART00000138327 Essential Splice Site 135 188 3 4

The following transcripts of ENSDARG00000003599 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 30019526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGCTGGACAGAAGGGCTACCACCACCGCACAGAAATCAACAAAAAGG[T/A]AATGCTTCAGAAAGTCACTCAAATGTTCATGGCATACGTTTGTGGACGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16344
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011251 None None 403 None 9
ENSDART00000138327 Nonsense 174 188 4 4

The following transcripts of ENSDARG00000003599 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 30019318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTATGATCTGTCCAACAAGAGCAWMAACCCTCTGGTGAGTGTGCTGT[T/A]GTCTCCCTATTGTGAATTTGATAAATTNNGTTTATATGCATGCATTAWTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7v3uuka0