klhl32

Ensembl ID:
ENSDARG00000003576
ZFIN ID:
ZDB-GENE-070209-47
Description:
kelch-like protein 32 [Source:RefSeq peptide;Acc:NP_001076491]
Human Orthologue:
KLHL32
Human Description:
kelch-like 32 (Drosophila) [Source:HGNC Symbol;Acc:21221]
Mouse Orthologue:
Klhl32
Mouse Description:
kelch-like 32 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:3612790]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39115 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017562 Splice Site, Nonsense 209 620 7 12

The following transcripts of ENSDARG00000003576 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34575581)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32307081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTACTGAAGAGCGACCGCCTCACCTCCCTCAGCGAAGAGGAGATATGG[C/T]AGGTGTGTGGGCCGCACATTCACTCACTTTAACTGCTCCAAACTTTTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link