hsp90b1

Ensembl ID:
ENSDARG00000003570
ZFIN ID:
ZDB-GENE-031002-1
Description:
endoplasmin [Source:RefSeq peptide;Acc:NP_937853]
Human Orthologues:
HSP90B1, HSP90B2P
Human Descriptions:
heat shock protein 90kDa beta (Grp94), member 1 [Source:HGNC Symbol;Acc:12028]
heat shock protein 90kDa beta (Grp94), member 2 (pseudogene) [Source:HGNC Symbol;Acc:12099]
Mouse Orthologue:
Hsp90b1
Mouse Description:
heat shock protein 90, beta (Grp94), member 1 Gene [Source:MGI Symbol;Acc:MGI:98817]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12898 Nonsense Available for shipment Available now
sa40227 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004879 Nonsense 359 793 8 18

The following transcripts of ENSDARG00000003570 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 8902366)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9839214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCAGAGACCTGCAAAGGAAGTGGAGGAAGATGAATATACAGCCTTCTA[T/G]AAAACTTTCTCCAGGGTKAGTAAAACYGGTGTGTGGCACAAATGGTTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004879 Essential Splice Site 785 793 None 18

The following transcripts of ENSDARG00000003570 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 8905706)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9842554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGAGGATGAGGAGGAGGTCCAGGCAGATGAAGCAGAAGAGGAATCAG[T/C]GAGTGCCCTTCCAAACAAAAGTCTCTTTAGGAGCTGGAATTCTGGTCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hypertension: Two-marker association tests yield new disease associations for coronary artery disease and hypertension. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link