gnrhr2

Ensembl ID:
ENSDARG00000003553
ZFIN ID:
ZDB-GENE-090128-3
Description:
gonadotropin releasing hormone receptor 2 [Source:RefSeq peptide;Acc:NP_001138451]
Human Orthologue:
GNRHR
Human Description:
gonadotropin-releasing hormone receptor [Source:HGNC Symbol;Acc:4421]
Mouse Orthologue:
Gnrhr
Mouse Description:
gonadotropin releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95790]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31599 Nonsense Available for shipment Available now
sa41021 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006795 Nonsense 162 412 1 3
Genomic Location (Zv9):
Chromosome 7 (position 53820312)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52090162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCTCAACCCTCTGTCCATCAACAAGGCGATGAGAAGAAATAAAGTTT[T/A]GCTGGGCGTCGCGTGGACCATGAGTGTCGTGTTGTCCATACCGCAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006795 Essential Splice Site 177 412 1 3
Genomic Location (Zv9):
Chromosome 7 (position 53820360)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52090210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCTGGGCGTCGCGTGGACCATGAGTGTCGTGTTGTCCATACCGCAGG[T/A]AAATAAACAGAGGCGCACAGATGAGAAGTTTGGGTTGGGTGAGATGTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link