unc45a

Ensembl ID:
ENSDARG00000003546
ZFIN IDs:
ZDB-GENE-050417-158, ZDB-GENE-050417-158, ZDB-GENE-050417-158
Description:
unc-45 homolog A [Source:RefSeq peptide;Acc:NP_001017671]
Human Orthologue:
UNC45A
Human Description:
unc-45 homolog A (C. elegans) [Source:HGNC Symbol;Acc:30594]
Mouse Orthologue:
Unc45a
Mouse Description:
unc-45 homolog A (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2142246]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15522 Essential Splice Site Available for shipment Available now
sa18626 Nonsense Available for shipment Available now
sa44243 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039786 Essential Splice Site 126 218 3 6
ENSDART00000103033 Essential Splice Site 126 935 3 20
ENSDART00000130466 Essential Splice Site 126 935 3 19
Genomic Location (Zv9):
Chromosome 25 (position 8885556)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8580621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTTTCCAGGATCTKCTTAGACAGCTCGGAGCTCAGATCCAGCAGAAG[G/T]TGTGGGTTAWGAGTGATGCTCGCACTGTTAATATTAATGATSTGAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039786   None 218 None 6
ENSDART00000103033 Nonsense 574 935 12 20
ENSDART00000130466 Nonsense 574 935 12 19
Genomic Location (Zv9):
Chromosome 25 (position 8870163)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8565228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTTGATTGCAGTCCGAGGACAAAACTGTGTTGTTTGCGGTGGGAT[C/A]GACACTGGTAAACTGCACCAAYAGCTACGATGTRGAGAAGCCAGACCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039786   None 218 None 6
ENSDART00000103033 Nonsense 601 935 12 20
ENSDART00000130466 Nonsense 601 935 12 19
Genomic Location (Zv9):
Chromosome 25 (position 8870083)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8565148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGGAGAAGCCAGACCCGCAGATGGTGGAGCTAGCTAAATATGCTAAA[C/T]AACATGTACCAGAGGAGCATCCAAAGGTGATTTATGCGGATAGGATTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link