unc45a

Ensembl ID:
ENSDARG00000003546
ZFIN IDs:
ZDB-GENE-050417-158, ZDB-GENE-050417-158, ZDB-GENE-050417-158
Description:
unc-45 homolog A [Source:RefSeq peptide;Acc:NP_001017671]
Human Orthologue:
UNC45A
Human Description:
unc-45 homolog A (C. elegans) [Source:HGNC Symbol;Acc:30594]
Mouse Orthologue:
Unc45a
Mouse Description:
unc-45 homolog A (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2142246]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15522 Essential Splice Site Available for shipment Available now
sa18626 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039786 Essential Splice Site 126 218 3 6
ENSDART00000103033 Essential Splice Site 126 935 3 20
ENSDART00000130466 Essential Splice Site 126 935 3 19
Genomic Location:
Chromosome 25 (position 8885556)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTTTCCAGGATCTKCTTAGACAGCTCGGAGCTCAGATCCAGCAGAAG[G/T]TGTGGGTTAWGAGTGATGCTCGCACTGTTAATATTAATGATSTGAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039786 None None 218 None 6
ENSDART00000103033 Nonsense 574 935 12 20
ENSDART00000130466 Nonsense 574 935 12 19
Genomic Location:
Chromosome 25 (position 8870163)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTTGATTGCAGTCCGAGGACAAAACTGTGTTGTTTGCGGTGGGAT[C/A]GACACTGGTAAACTGCACCAAYAGCTACGATGTRGAGAAGCCAGACCCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5o1opbfe