si:ch211-268b13.2

Ensembl ID:
ENSDARG00000003544
ZFIN ID:
ZDB-GENE-030219-15
Human Orthologue:
ADARB1
Human Description:
adenosine deaminase, RNA-specific, B1 [Source:HGNC Symbol;Acc:226]
Mouse Orthologue:
Adarb1
Mouse Description:
adenosine deaminase, RNA-specific, B1 Gene [Source:MGI Symbol;Acc:MGI:891999]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11903 Nonsense Available for shipment Available now
sa21595 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024657 Nonsense 433 728 4 9
ENSDART00000145616 Nonsense 404 699 4 9
Genomic Location (Zv9):
Chromosome 9 (position 46586977)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45718257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAACGACTGTCACGCTGAAATCATTGCTCGTCGTTCCCTCATCAGGTA[T/A]CTCTACATGCAGCTGGAGCACTTCTTAAGGTGAGACGCCGCATTCATGNNNNNNNNNNNNTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024657 Nonsense 651 728 8 9
ENSDART00000145616 Nonsense 622 699 8 9
Genomic Location (Zv9):
Chromosome 9 (position 46608660)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45739940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGGCTCTAGAAGTCATTAATGCCACCACAGGCAAAGATGACATGGGC[A/T]GAGCATCACGACTCTGCAAACACGCTCTCTACAGCCGCTGGGTCAGACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link