col8a1b

Ensembl ID:
ENSDARG00000003533
ZFIN ID:
ZDB-GENE-060503-140
Description:
Novel protein similar to vertebrate collagen, type VIII, alpha 1 (COL8A1) [Source:UniProtKB/TrEMBL;A
Human Orthologue:
COL8A1
Human Description:
collagen, type VIII, alpha 1 [Source:HGNC Symbol;Acc:2215]
Mouse Orthologue:
Col8a1
Mouse Description:
collagen, type VIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88463]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14358 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019846 Nonsense 714 731 2 2
Genomic Location:
Chromosome 22 (position 29929215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGACACTGTTCAMGTTCAGTTACCATCAGAGCAAGCAGCAGGACTTTA[T/A]GCTGGTCCTTACRTCCACTCATCATTCTCTGGGTATTTGTTATATCCNNN
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3f12smnu