psma5

Ensembl ID:
ENSDARG00000003526
ZFIN ID:
ZDB-GENE-040625-96
Description:
proteasome subunit alpha type-5 [Source:RefSeq peptide;Acc:NP_991271]
Human Orthologue:
PSMA5
Human Description:
proteasome (prosome, macropain) subunit, alpha type, 5 [Source:HGNC Symbol;Acc:9534]
Mouse Orthologues:
Gm8394, Psma5
Mouse Descriptions:
predicted gene 8394 Gene [Source:MGI Symbol;Acc:MGI:3647964]
proteasome (prosome, macropain) subunit, alpha type 5 Gene [Source:MGI Symbol;Acc:MGI:1347009]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10901 Essential Splice Site Available for shipment Available now
sa19010 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30952 Nonsense Mutation detected in F1 DNA During 2017
sa21956 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020655 Essential Splice Site None 241 None 10
ENSDART00000141477   None 240 None 9
ENSDART00000146495   None 195 1 8
ENSDART00000020655 Essential Splice Site None 241 None 10
ENSDART00000141477   None 240 None 9
ENSDART00000146495   None 195 1 8
Genomic Location (Zv9):
Chromosome 11 (position 37191663)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36088891
KASP Assay ID:
2261-7168.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTTCCTGTACTGTTGAAACTAGCAAACTCACCCTCCACWGCWGAAGG[T/A]AAGAAATTCACRACATACTTCTATYATGCTGTGYTTWACTGCAGTAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020655 Essential Splice Site None 241 None 10
ENSDART00000141477   None 240 None 9
ENSDART00000146495   None 195 1 8
ENSDART00000020655 Essential Splice Site None 241 None 10
ENSDART00000141477   None 240 None 9
ENSDART00000146495   None 195 1 8
Genomic Location (Zv9):
Chromosome 11 (position 37191663)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36088891
KASP Assay ID:
2261-7168.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTTCCTGTACTGTTGAAACTAGCAAACTCACCCTCCACTGCAGAAGG[T/A]AAGAAATTCACAACATACTTCTATTATGCTGTGCTTTACTGCAGTAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020655 Nonsense 8 241 2 10
ENSDART00000141477 Nonsense 8 240 1 9
ENSDART00000146495 Nonsense 17 195 2 8
Genomic Location (Zv9):
Chromosome 11 (position 37191047)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36088275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTTACATAGATTTGCGTTTCAACATGTTCCTGACAAGATCAGAATA[T/G]GACAGGTGAGATATCAATGATATTTGTGCCGTGTAATTTAACTGCTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020655 Essential Splice Site 97 241 5 10
ENSDART00000141477 Essential Splice Site 97 240 4 9
ENSDART00000146495 Essential Splice Site 106 195 5 8
Genomic Location (Zv9):
Chromosome 11 (position 37188042)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36085270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATAGCTGATGCCAAAACTCTTATTGACAAAGCAAGAGTAGAAACACAG[G/T]TTGGTGAAAGTCTGTCACTTAAGTACAAGGTTACTTCAAATGTTTATTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link