itln3

Ensembl ID:
ENSDARG00000003523
ZFIN ID:
ZDB-GENE-090527-4
Description:
intelectin 3 [Source:RefSeq peptide;Acc:NP_001153056]
Human Orthologues:
ITLN1, ITLN2
Human Descriptions:
intelectin 1 (galactofuranose binding) [Source:HGNC Symbol;Acc:18259]
intelectin 2 [Source:HGNC Symbol;Acc:20599]
Mouse Orthologues:
Gm9765, Itln1
Mouse Descriptions:
intelectin 1 (galactofuranose binding) Gene [Source:MGI Symbol;Acc:MGI:1333831]
predicted gene 9765 Gene [Source:MGI Symbol;Acc:MGI:3642721]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35654 Nonsense Available for shipment Available now
sa7386 Missense Mutation detected in F1 DNA During 2017
sa28277 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003040 Nonsense 151 314 4 7
Genomic Location (Zv9):
Chromosome 14 (position 14036648)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16043030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAATCTGATGGTTTAATACTGTCACATCCTACAGAATCCTGGATATTA[T/A]GACATTTCTGCACAAGACGTCTCAGTGTGGCATGTTCCCAATAATGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003040 Missense 163 314 4 7
Genomic Location (Zv9):
Chromosome 14 (position 14036682)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16043064
KASP Assay ID:
554-4228.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATCCTGGATATTATGACATTTCTGCACAAGACGTCTCAGTGTGGCAT[G/T]TTCCCAATAATGAGCAGTTGAAAAAGTGGACATCTTCTGCCATCCTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003040 Nonsense 290 314 7 7
Genomic Location (Zv9):
Chromosome 14 (position 14041025)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16046331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTATTGTATTGGCGGAGGAGGATTTTTTGTCCAGCCTGAGCAGTGT[G/T]GAGACTTCACAGCACTGGACCTGAAAGAAACATTTAAACAACCCACTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link