si:dkey-120m5.1

Ensembl ID:
ENSDARG00000003520
ZFIN ID:
ZDB-GENE-030131-6136
Human Orthologue:
TBC1D14
Human Description:
TBC1 domain family, member 14 [Source:HGNC Symbol;Acc:29246]
Mouse Orthologue:
Tbc1d14
Mouse Description:
TBC1 domain family, member 14 Gene [Source:MGI Symbol;Acc:MGI:1098708]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12027 Essential Splice Site Available for shipment Available now
sa10659 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040946 Essential Splice Site 368 711 None 14
ENSDART00000133420 Essential Splice Site 368 711 None 15

The following transcripts of ENSDARG00000003520 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41086400)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39422657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTTCACTGCTATTCTGCCTCTCACTCTGTGCACTTGTGATTCTGTCC[A/T]GAGCTGAAAGAYGCCCAGAAACGAAAGAAACAGCTGGAGGACCGGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040946 Essential Splice Site 472 711 None 14
ENSDART00000133420 Essential Splice Site 472 711 None 15

The following transcripts of ENSDARG00000003520 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41088280)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39424537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAATGCCTTTGTAGCCCCAACRGCTGCTGYGGAAACTGAAAGTGAAGG[T/G]GATTTAATMAAWTCTATTTTTMAGCTTTCTAAYATTTTAAAACTTAAGYA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link