aprt

Ensembl ID:
ENSDARG00000003519
ZFIN ID:
ZDB-GENE-040426-1492
Description:
adenine phosphoribosyltransferase [Source:RefSeq peptide;Acc:NP_956962]
Human Orthologue:
APRT
Human Description:
adenine phosphoribosyltransferase [Source:HGNC Symbol;Acc:626]
Mouse Orthologue:
Aprt
Mouse Description:
adenine phosphoribosyl transferase Gene [Source:MGI Symbol;Acc:MGI:88061]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12964 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013796 Nonsense 75 177 3 5
Genomic Location:
Chromosome 7 (position 56799769)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCTAGGACTTGATGCTCGAGGGTTTCTATTCGGGCCACTTTTGGCTT[T/A]GAGATTAGGAATAGGATTYGCTCCGATCAGGAAAAAAGGAAAGCTCCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qlp2qhl8