anks1b

Ensembl ID:
ENSDARG00000003512
ZFIN ID:
ZDB-GENE-041210-349
Description:
Ankyrin repeat and sterile alpha motif domain-containing protein 1B [Source:UniProtKB/Swiss-Prot;Acc
Human Orthologue:
ANKS1B
Human Description:
ankyrin repeat and sterile alpha motif domain containing 1B [Source:HGNC Symbol;Acc:24600]
Mouse Orthologue:
Anks1b
Mouse Description:
ankyrin repeat and sterile alpha motif domain containing 1B Gene [Source:MGI Symbol;Acc:MGI:1924781]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40270 Nonsense Mutation detected in F1 DNA During 2016
sa20254 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2161 Essential Splice Site F2 line generated During 2016
sa16530 Nonsense Available for shipment Available now
sa15624 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024367 Nonsense 275 1281 6 26
ENSDART00000133509 Nonsense 275 1280 6 26

The following transcripts of ENSDARG00000003512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 17176788)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18119628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAACTGCACTAGATATACTTAGAGAACATCCGTCTCAGAAATCACAA[C/T]AAATTGCTTCTCTCATACACGGTAAAGTGTTTCACAGATTTCTATACGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024367 Essential Splice Site 282 1281 7 26
ENSDART00000133509 Essential Splice Site 282 1280 7 26

The following transcripts of ENSDARG00000003512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 17175615)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18118455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTATGTTTGTCTGTTTATTGTATGTTAATAAATTGTTTTTCCCTCT[A/G]GATTATATGATGTCAGATTGTGACAGAGGGAATTTTCACGAAGACTTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2161
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024367 Essential Splice Site 423 1281 10 26
ENSDART00000133509 Essential Splice Site 423 1280 10 26

The following transcripts of ENSDARG00000003512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 17153738)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18096578
KASP Assay ID:
554-2938.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATATATTTATCTGTTATGACTCTATTTTCTGTCATSTTGTCTGTTTGC[A/T]GGACAAGCGATGTGTTGAAATTGCCCATTCTCCATCACTGGATGTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024367 Nonsense 725 1281 13 26
ENSDART00000133509 Nonsense 725 1280 13 26

The following transcripts of ENSDARG00000003512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 17067417)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18010257
KASP Assay ID:
2259-4806.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCAACTGCACAGGTGGCTCYAKTCCAGCAAACAGYAATACAGGCTAC[G/T]AAGAAAGAGCCTGCACTCTTGGGAGGATGAGGTCTATGCCAAAAAACGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024367 Nonsense 877 1281 16 26
ENSDART00000133509 Nonsense 877 1280 16 26

The following transcripts of ENSDARG00000003512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 17045893)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17988733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGGAGGACCAGGACCTGCTGGAGATTGGGATTTTAAACTCTGCCCAC[A/T]GACARCGACTTCTTCAGGCTATTCGCCTTTTGCCCAGGGTGAGTAGAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link