
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
anks1b
- Ensembl ID:
- ENSDARG00000003512
- ZFIN ID:
- ZDB-GENE-041210-349
- Description:
- Ankyrin repeat and sterile alpha motif domain-containing protein 1B [Source:UniProtKB/Swiss-Prot;Acc
- Human Orthologue:
- ANKS1B
- Human Description:
- ankyrin repeat and sterile alpha motif domain containing 1B [Source:HGNC Symbol;Acc:24600]
- Mouse Orthologue:
- Anks1b
- Mouse Description:
- ankyrin repeat and sterile alpha motif domain containing 1B Gene [Source:MGI Symbol;Acc:MGI:1924781]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40270 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa20254 | Essential Splice Site | Available for shipment | Available now |
sa2161 | Essential Splice Site | F2 line generated | During 2018 |
sa16530 | Nonsense | Available for shipment | Available now |
sa15624 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa40270
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024367 | Nonsense | 275 | 1281 | 6 | 26 |
ENSDART00000133509 | Nonsense | 275 | 1280 | 6 | 26 |
The following transcripts of ENSDARG00000003512 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 4 (position 17176788)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 18119628 GRCz11 4 18108604 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAGAACTGCACTAGATATACTTAGAGAACATCCGTCTCAGAAATCACAA[C/T]AAATTGCTTCTCTCATACACGGTAAAGTGTTTCACAGATTTCTATACGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20254
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024367 | Essential Splice Site | 282 | 1281 | 7 | 26 |
ENSDART00000133509 | Essential Splice Site | 282 | 1280 | 7 | 26 |
The following transcripts of ENSDARG00000003512 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 4 (position 17175615)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 18118455 GRCz11 4 18107431 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGTTTATGTTTGTCTGTTTATTGTATGTTAATAAATTGTTTTTCCCTCT[A/G]GATTATATGATGTCAGATTGTGACAGAGGGAATTTTCACGAAGACTTAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2161
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024367 | Essential Splice Site | 423 | 1281 | 10 | 26 |
ENSDART00000133509 | Essential Splice Site | 423 | 1280 | 10 | 26 |
The following transcripts of ENSDARG00000003512 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 4 (position 17153738)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 18096578 GRCz11 4 18085554 - KASP Assay ID:
- 554-2938.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTATATATTTATCTGTTATGACTCTATTTTCTGTCATSTTGTCTGTTTGC[A/T]GGACAAGCGATGTGTTGAAATTGCCCATTCTCCATCACTGGATGTGTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16530
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024367 | Nonsense | 725 | 1281 | 13 | 26 |
ENSDART00000133509 | Nonsense | 725 | 1280 | 13 | 26 |
The following transcripts of ENSDARG00000003512 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 4 (position 17067417)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 18010257 GRCz11 4 17999233 - KASP Assay ID:
- 2259-4806.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGAGCAACTGCACAGGTGGCTCYAKTCCAGCAAACAGYAATACAGGCTAC[G/T]AAGAAAGAGCCTGCACTCTTGGGAGGATGAGGTCTATGCCAAAAAACGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15624
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024367 | Nonsense | 877 | 1281 | 16 | 26 |
ENSDART00000133509 | Nonsense | 877 | 1280 | 16 | 26 |
The following transcripts of ENSDARG00000003512 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 4 (position 17045893)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 17988733 GRCz11 4 17977709 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGTGGAGGACCAGGACCTGCTGGAGATTGGGATTTTAAACTCTGCCCAC[A/T]GACARCGACTTCTTCAGGCTATTCGCCTTTTGCCCAGGGTGAGTAGAGAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Amyotrophic lateral sclerosis (age of onset): Age of onset of amyotrophic lateral sclerosis is modulated by a locus on 1p34.1. (View Study)
- Autism spectrum disorder, attention deficit-hyperactivity disorder, bipolar disorder, major depressive disorder, and schizophrenia (combined): Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis. (View Study)
- Metabolite levels (MHPG): Genome-wide association study of monoamine metabolite levels in human cerebrospinal fluid. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Response to antipsychotic treatment: Genome-wide pharmacogenomic analysis of response to treatment with antipsychotics. (View Study)
- Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)
- Working memory: Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: