mrpl3

Ensembl ID:
ENSDARG00000003511
ZFIN ID:
ZDB-GENE-030131-8227
Description:
39S ribosomal protein L3, mitochondrial [Source:RefSeq peptide;Acc:NP_956301]
Human Orthologue:
MRPL3
Human Description:
mitochondrial ribosomal protein L3 [Source:HGNC Symbol;Acc:10379]
Mouse Orthologue:
Mrpl3
Mouse Description:
mitochondrial ribosomal protein L3 Gene [Source:MGI Symbol;Acc:MGI:2137204]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5920 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa5920
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020928 Nonsense 161 345 5 10
ENSDART00000104399 Nonsense 135 319 6 11
ENSDART00000138823 None None 137 None 4
Genomic Location:
Chromosome 19 (position 18783120)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGTCAAGCTATTATTTAATTTTTTTTTTTTTCAGAGGCCGGKGGGATA[T/G]TTGGAGATTTTYCAGAATGCAGGAATTCCACCCAAGCAGAAACTCACCAC
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
liver
ZFA:0000123
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
pancreas
ZFA:0000140
absent
PATO:0000462
abnormal
PATO:0000460

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7pm0g9yz