madd

Ensembl ID:
ENSDARG00000003495
Human Orthologue:
MADD
Human Description:
MAP-kinase activating death domain [Source:HGNC Symbol;Acc:6766]
Mouse Orthologue:
Madd
Mouse Description:
MAP-kinase activating death domain Gene [Source:MGI Symbol;Acc:MGI:2444672]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13587 Nonsense Available for shipment Available now
sa12918 Nonsense Available for shipment Available now
sa8273 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047208 Nonsense 7 1641 1 35
Genomic Location:
Chromosome 7 (position 35724071)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGACTTAGAGACACTCCTGATACAGAGWTGGAGAAAAAGAAAATGTG[T/A]CCCCGCCTCCTGGACTACCTGGTGGTAGTTGGAGCCAGGTAAGSAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047208 Nonsense 169 1641 3 35
Genomic Location:
Chromosome 7 (position 35721544)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCGAGCCGGGTAGCAGCGGGAAGTCTCCGCGATCTAAACGCAGTGGC[C/T]GAATAGCACCACAGAAYCGCAACAGCATGTTAACATCTCTGTGTATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047208 Nonsense 539 1641 9 35
Genomic Location:
Chromosome 7 (position 35697573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCTGTGGTGGCCTTTCAGTCCACATCTTTCCTGGCTTCTAGGCCACGA[C/T]GAAATGGATTCACAGAAAAGCTCTCCCACACTCAGGCAGTGGAGTACTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k5r2d3w7