madd

Ensembl ID:
ENSDARG00000003495
Human Orthologue:
MADD
Human Description:
MAP-kinase activating death domain [Source:HGNC Symbol;Acc:6766]
Mouse Orthologue:
Madd
Mouse Description:
MAP-kinase activating death domain Gene [Source:MGI Symbol;Acc:MGI:2444672]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13587 Nonsense Available for shipment Available now
sa40945 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12918 Nonsense Available for shipment Available now
sa40944 Nonsense Mutation detected in F1 DNA During 2016
sa34115 Nonsense Mutation detected in F1 DNA During 2016
sa40943 Nonsense Mutation detected in F1 DNA During 2016
sa34114 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047208 Nonsense 7 1641 1 35
Genomic Location (Zv9):
Chromosome 7 (position 35724071)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34114039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGACTTAGAGACACTCCTGATACAGAGWTGGAGAAAAAGAAAATGTG[T/A]CCCCGCCTCCTGGACTACCTGGTGGTAGTTGGAGCCAGGTAAGSAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047208 Essential Splice Site 113 1641 2 35
Genomic Location (Zv9):
Chromosome 7 (position 35721859)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34111827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCGCTCTTTTCAAAAGGCCCACCATCGCCCAAGAGCTGAAGGAAAAGG[T/C]TAGCGGTCACTTTGGTGCAGTATTGTACTGCTTTAATCCATGTGTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047208 Nonsense 169 1641 3 35
Genomic Location (Zv9):
Chromosome 7 (position 35721544)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34111512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCGAGCCGGGTAGCAGCGGGAAGTCTCCGCGATCTAAACGCAGTGGC[C/T]GAATAGCACCACAGAAYCGCAACAGCATGTTAACATCTCTGTGTATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047208 Nonsense 350 1641 5 35
Genomic Location (Zv9):
Chromosome 7 (position 35703597)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34089409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTATAACGCTCTCTCAATGAGCGTCATGGCGTTTGTTTCGATGATTTA[C/A]CCTCTTGAGTACATGTTTCCTGTCATTCCACTGTTGCCCACCTGCATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047208 Nonsense 611 1641 10 35
Genomic Location (Zv9):
Chromosome 7 (position 35696978)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34082790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCTACCGCGTGTATGATGGAAACTCTCATTTAGCGGAGGCCTTGAGT[G/T]GACCCCTGCAGGATGAGACCAATGATTCAGACCCAACAGACGACAGGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047208 Nonsense 881 1641 15 35
Genomic Location (Zv9):
Chromosome 7 (position 35694187)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34079999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCACCAGTTTCAGTCTGTCCAGCCTGGCTCTGCCTAATAAAGCGAGA[G/T]AGAAGAACACGCCGTTTCCCAGCCTCAAAGGTACACGCATTCCCTTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047208 Essential Splice Site 1342 1641 26 35
Genomic Location (Zv9):
Chromosome 7 (position 35674721)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34060542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACGGGAAGGAATGGGAATGGATCAGGGACCACAAGAAATGATTGACAG[G/A]TTTGTGTGTGTGTTGTTAAGTGCCTGCAGGAGTTATCATGCAGCAACGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link