dye

Ensembl ID:
ENSDARG00000003487
ZFIN ID:
ZDB-GENE-990415-46
Description:
Nuclear pore complex protein Nup93 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZU29]
Human Orthologue:
NUP93
Human Description:
nucleoporin 93kDa [Source:HGNC Symbol;Acc:28958]
Mouse Orthologue:
Nup93
Mouse Description:
nucleoporin 93 Gene [Source:MGI Symbol;Acc:MGI:1919055]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43076 Nonsense Mutation detected in F1 DNA During 2017
sa23272 Nonsense Available for shipment Available now
sa36620 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025782 Nonsense 252 820 8 22
ENSDART00000100261   None 110 None 4
ENSDART00000147839   None 110 None 3

The following transcripts of ENSDARG00000003487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 17224038)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17575804
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGTGCCAGCAAAAGACACTCTGAAGAGTCGAGTGTCTGTGGACATG[C/T]AGATGGCCTTCGTCAGACAAGCCCTGCAGTTCCTGGAGAACAGGTGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025782 Nonsense 509 820 13 22
ENSDART00000100261   None 110 None 4
ENSDART00000147839   None 110 None 3

The following transcripts of ENSDARG00000003487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 17228475)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17580241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTTGCTCTGGTGCTGTACGAACTCAAACTCCTGCTCAAATCATCAGGA[C/T]AGAGCGCTCAACTCTGTAAGTTGTGACTATTGAGCGTTAAGTGAGAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025782 Nonsense 723 820 20 22
ENSDART00000100261   None 110 None 4
ENSDART00000147839   None 110 None 3

The following transcripts of ENSDARG00000003487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 17235468)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17587234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCTCCAATTCTGTGTCAGGTGATCGAGAGGCTCAAGTTGGTTCCCT[T/G]AAGTCAGGACAGTGTTGAGGAGCGAGTTGCTGCCTTCAGAAACTTCAGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Gambling: Genome-wide association study of a quantitative disordered gambling trait. (View Study)
  • HDL cholesterol: Polymorphism in the CETP gene region, HDL cholesterol, and risk of future myocardial infarction: Genomewide analysis among 18 245 initially healthy women from the Women's Genome Health Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link