ppp1caa

Ensembl ID:
ENSDARG00000003486
ZFIN ID:
ZDB-GENE-040516-3
Description:
protein phosphatase 1, catalytic subunit, alpha [Source:RefSeq peptide;Acc:NP_999976]
Human Orthologues:
PPP1CA, PPP1CC
Human Descriptions:
protein phosphatase 1, catalytic subunit, alpha isozyme [Source:HGNC Symbol;Acc:9281]
protein phosphatase 1, catalytic subunit, gamma isozyme [Source:HGNC Symbol;Acc:9283]
Mouse Orthologues:
Ppp1ca, Ppp1cc
Mouse Descriptions:
protein phosphatase 1, catalytic subunit, alpha isoform Gene [Source:MGI Symbol;Acc:MGI:103016]
protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI Symbol;Acc:MGI:104872]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8688 Nonsense Mutation detected in F1 DNA During 2017
sa26083 Nonsense Mutation detected in F1 DNA During 2017
sa40087 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025046 Nonsense 70 331 3 7
Genomic Location (Zv9):
Chromosome 3 (position 31048639)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30766678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTTNNNNNNNNNNNATCTGCAGGTGATGTCCATGGTCAGTACTA[T/A]GATCTTCTTCGTCTCTTCGAGTATGGGGGCTTTCCTCCTGAGAGTAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025046 Nonsense 114 331 3 7
Genomic Location (Zv9):
Chromosome 3 (position 31048507)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30766546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGTCCCTAGAGACAATCTGCCTCCTGTTGGCCTACAAAGTCAAATA[T/A]CCTGAAAACTTCTTCCTGCTGCGTGGCAACCACGAGTGCGCCTCTATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025046 Nonsense 137 331 3 7
Genomic Location (Zv9):
Chromosome 3 (position 31048438)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30766477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCGTGGCAACCACGAGTGCGCCTCTATCAATCGTATATATGGCTTCTA[T/A]GATGAGTGTTAGTATCAGTTTGAAAAACAAATTTGATCATCTACAAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link