NP_957396.1

Ensembl ID:
ENSDARG00000003449
Description:
cAMP and cAMP-inhibited cGMP 3',5'-cyclic phosphodiesterase 10A [Source:RefSeq peptide;Acc:NP_95739
Human Orthologue:
PDE10A
Human Description:
phosphodiesterase 10A [Source:HGNC Symbol;Acc:8772]
Mouse Orthologue:
Pde10a
Mouse Description:
phosphodiesterase 10A Gene [Source:MGI Symbol;Acc:MGI:1345143]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35407 Nonsense Mutation detected in F1 DNA During 2017
sa38918 Essential Splice Site Mutation detected in F1 DNA During 2017
sa28054 Nonsense Mutation detected in F1 DNA During 2017
sa17787 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007500 Nonsense 372 843 13 23
ENSDART00000144312 Nonsense 351 734 12 20
Genomic Location (Zv9):
Chromosome 13 (position 4255699)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4472619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAACATCTGTTCTGCTTTTCATAGAGAAGTAGATCTCTACACTGGCTA[C/A]ACGACGCGGAATATCCTGTGCATGCCCATAGTCAGCCGCGGGACTGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007500 Essential Splice Site 427 843 14 23
ENSDART00000144312 Essential Splice Site 406 734 13 20
Genomic Location (Zv9):
Chromosome 13 (position 4256743)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4473663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTTTGCATCTGCGTAAAAGACACATGGGGCGTTTGTGTTTGTGTGTA[G/A]ATGTATCACCGGATAAGACATTCAGAGTGCATTTACCGGGTGACCATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007500 Nonsense 742 843 21 23
ENSDART00000144312 Nonsense 722 734 20 20
Genomic Location (Zv9):
Chromosome 13 (position 4269760)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4486680
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGGGTTTTACAATGCAGTGGCTATTCCCTGTTACACCACTCTGTCT[G/T]AGCTGTTTCCTCCCTCCGTTCCTTTGCTTGAAGCTTGCAGGTAAGTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007500 Nonsense 837 843 23 23
ENSDART00000144312   None 734 None 20
Genomic Location (Zv9):
Chromosome 13 (position 4274986)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4491816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGCAGAGACGGGAGGAAGTGCAGAGGGCAGGCGGACGAGGATACTTTC[A/T]RAAAAAAAATAAACAAAACATAATGTTACCTCAGYGGGTGATGGAGGCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link