ippk

Ensembl ID:
ENSDARG00000003446
ZFIN ID:
ZDB-GENE-050327-41
Description:
Inositol-pentakisphosphate 2-kinase [Source:UniProtKB/Swiss-Prot;Acc:Q4JL91]
Human Orthologue:
IPPK
Human Description:
inositol 1,3,4,5,6-pentakisphosphate 2-kinase [Source:HGNC Symbol;Acc:14645]
Mouse Orthologue:
Ippk
Mouse Description:
inositol 1,3,4,5,6-pentakisphosphate 2-kinase Gene [Source:MGI Symbol;Acc:MGI:1922928]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24085 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019615 Essential Splice Site 355 483 10 13
ENSDART00000131217 Essential Splice Site 392 520 10 13
Genomic Location (Zv9):
Chromosome 22 (position 10630452)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10490620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTGTACAAGCGCGTGGAGCAGTATCTAGAGGAGTTCCCGAAAGAAAG[G/A]TGAACCTGCTATCTGGGATATTGACTGCTACGTTACTGATCTATCAGGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link