igf2bp2a

Ensembl ID:
ENSDARG00000003421
ZFIN ID:
ZDB-GENE-070912-44
Description:
insulin-like growth factor 2 mRNA binding protein 2a [Source:RefSeq peptide;Acc:NP_001108030]
Human Orthologue:
IGF2BP2
Human Description:
insulin-like growth factor 2 mRNA binding protein 2 [Source:HGNC Symbol;Acc:28867]
Mouse Orthologue:
Igf2bp2
Mouse Description:
insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890358]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21443 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102419 Nonsense 402 606 10 16
ENSDART00000128931 Nonsense 402 607 10 16
Genomic Location (Zv9):
Chromosome 9 (position 12767665)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12520230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCAGCTGCTGGACCCAGAGGCATCCCACCCGTACCCCCAACCGGCTA[C/A]AACCCTTTTCTTGTGAGTACAAACATCGGTGTGGGCTTTATTATGTAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Diabetes (gestational): A genome-wide association study of gestational diabetes mellitus in Korean women. (View Study)
  • Fasting insulin-related traits (interaction with BMI): A genome-wide approach accounting for body mass index identifies genetic variants influencing fasting glycemic traits and insulin resistance. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Type 2 diabetes: A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. (View Study)
  • Type 2 diabetes: Confirmation of multiple risk Loci and genetic impacts by a genome-wide association study of type 2 diabetes in the Japanese population. (View Study)
  • Type 2 diabetes: Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels. (View Study)
  • Type 2 diabetes: Genome-wide association study identifies a novel locus contributing to type 2 diabetes susceptibility in Sikhs of Punjabi origin from India. (View Study)
  • Type 2 diabetes: Genome-wide association study of type 2 diabetes in a sample from Mexico City and a meta-analysis of a Mexican-American sample from Starr County, Texas. (View Study)
  • Type 2 diabetes: Meta-analysis of genome-wide association data and large-scale replication identifies additional susceptibility loci for type 2 diabetes. (View Study)
  • Type 2 diabetes: Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes. (View Study)
  • Type 2 diabetes: SNPs in KCNQ1 are associated with susceptibility to type 2 diabetes in East Asian and European populations. (View Study)
  • Type 2 diabetes: Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link